Precision Sequencing. Fast. Reliable. Expert.

The sequencing marketplace with expert NGS guidance for every researcher. We advise on the best strategy, match you with the right provider, and manage it end to end, from sample collection to result delivery.

Explore Services Get a Quote →

What We Offer

Three Core Services

From high-throughput Next-Generation sequencing to classical Sanger and deep bioinformatics, everything under one roof.

Next-Generation Sequencing

High-throughput NGS for any application, Whole Genome, RNA-seq, Amplicon sequencing and more. High capacity with fast Turnaround Time.

  • Whole Genome & Exome Sequencing
  • RNA-seq / Transcriptomics
  • Custom Amplicon Panels
Illumina · Nanopore · Ultima Genomics · PacBio
CTTACAACTTGCCTTCCGTCTTACAACTTGCCTTCCGT

Sanger Sequencing

Classic Sanger sequencing with high accuracy for clone verification, point mutations, and genotyping. Results within 24–48 hours.

  • Single & Multiplex Reactions
  • Plasmid & PCR Template
  • Primer Design Assistance
Rush & Standard TAT Available

Bioinformatics Analysis

Comprehensive bioinformatics: from mapping and assembly to functional analysis, visualization, and detailed reports.

  • Variant Calling & Annotation
  • Differential Expression (DESeq2)
  • De-novo Assembly
  • Custom Pipeline Development
Custom Pipelines
Custom
Flexible TAT
99.9%
Data Quality
24/7
Expert Support

How It Works

Simple 4-Step Process

You bring the experiment idea. From consultation, through the quote, to final results, we handle everything else.

STEP 01

Consultation

You bring the experiment idea, and our NGS experts advise on the best strategy and study design.

STEP 02

Quote & Provider Match

We match you with the right provider and send a clear, formal quote within one business day.

STEP 03

Sequencing & QC

We arrange sample collection and manage library prep, sequencing, and quality checks, all for you.

STEP 04

Final Results

Raw data and/or a full bioinformatics report, delivered via secure portal.

Why QuickSeq

Science You Can Trust

Backed by 20+ years of hands-on experience in sequencing and genomics, from experimental design to publication-ready data.

Flexible Turnaround

Flexible Turnaround

Rush, standard, or scheduled, choose the TAT that fits your timeline and budget.

High Accuracy

High Accuracy

Rigorous QC at every step to support publication-quality data.

20+ Years of Expertise

20+ Years of Expertise

Two decades of hands-on experience in NGS, Sanger, and bioinformatics, guiding researchers from design to discovery.

Data Security

Data Security

Encrypted transfer and secure storage. Full NDA available upon request.

Scientist-Led Support

Scientist-Led Support

A dedicated NGS scientist guides your project, from experimental design to the final report.

Flexible Pricing

Flexible Pricing

Transparent per-sample prices up front, with volume discounts on larger projects and a formal quote within one business day.

Get Started

Ready to sequence?

Three ways to reach us, choose what works best for you.

Email Us

For a personalized quote tailored to your project, send us an email and we'll get back to you the same day.

Open Email →

Get an Instant Quote

Choose a service and submit a quote request in minutes.

Get a Quote →

Call Us

Speak directly with one of our scientists, we're happy to help.

Oded · 050-599-7710 Ronen · 054-661-0304
QuickSeq
Services Process Why Us About Us 👤 Sign In Contact